9 Conditionals and Loops in Python
- Be able to code conditional statements and loops in Python
- Understand how to handle errors (exceptions) and edge cases in programs
- Compare different Python methods and their pros and cons
9.1 Conditionals
Conditionals in Python allow you to execute different blocks of code based on conditions with boolean outputs. This is mainly done using if, elif, and else statements.
if Statement:
The if statement evaluates a condition which has returned a boolean (True or False). If the condition is True, the block of code inside the if statement is executed.
elif Statement:
The elif (short for “else if”) statement allows you to check multiple conditions. It follows an if statement and is executed if the previous conditions were False and its own condition is True.
else Statement:
The else statement is used to execute a block of code if none of the preceding if or elif conditions were True.
Syntax
if condition:
print(x) # Code to execute if condition is True
elif another_condition:
print(y) # Code to execute if first condition is False and another_condition is True
else:
print(z) # Code to execute if all conditions are False
Note the colon and indentation used in the above example
- Indentation is also used to nest conditionals and loops in python, and incorrect indentation is a common cause for errors.
Here is a very simple example of using conditionals:
temperature = 25
if temperature > 30:
print("It's a hot day.")
#The program checks if the temperature is greater than 30. If it is, it prints "It's a hot day."
elif temperature < 10:
print("It's a cold day.")
#If the first condition is False, it checks if the temperature is less than 10. If this condition is True, it prints "It's a cold day."
else:
print("It's a pleasant day.")
#If both conditions are False, the else block executes and prints "It's a pleasant day."
With very simple conditions, python has a shorthand that is useful. You can do things like:
print("it's a hotday") if temperature > 30 else (print("it's a cold day") if temperature < 10 else print("it's a pleasent day"))
# these are known as ternary operators - there is no elif
Operators
The operators are a key tool when using conditional statements in python. Remind yourself about them and their order of precedence.
9.2 try and except in Python
In Python, try and except blocks are used for handling exceptions, which are errors that can occur during program execution. This mechanism allows developers to anticipate potential errors, provide alternate code to handle them, and prevent the program from crashing. Here’s how it works:
try Block:
The code that might raise an exception is placed inside the try block. If an exception occurs during execution of this block, the rest of the block is skipped, and control is passed to the except block.
except Block:
This block contains code that handles the exception. You can specify which exception to catch, or leave it blank to catch any exception. If the exception type matches the one specified in the except block, the code inside it is executed.
Multiple except Blocks:
You can have multiple except blocks to handle different types of exceptions.
else Block:
You can add an else block after the except block. This block runs if the try block executes without raising an exception.
finally Block:
The finally block runs regardless of whether an exception was raised or not. It is often used for cleanup actions, like closing files or releasing resources.
Example
Here’s a simple example demonstrating the use of try and except:
try:
# Code that may raise an exception
numerator = 10
denominator = 0
result = numerator / denominator
except ZeroDivisionError:
# Handling a specific exception
print("Error: You cannot divide by zero.")
except Exception as e:
# Handling any other exception
print(f"An unexpected error occurred: {e}")
else:
# Executes if no exception occurred
print("The result is:", result)
finally:
# This block runs no matter what
print("Execution completed.")Explanation of the Example:
try:
- Attempts to divide
numeratorbydenominator. Sincedenominatoris zero, this raises aZeroDivisionError.
except:
- The first
exceptcatches theZeroDivisionErrorand prints an error message. - The second
exceptwould catch any other unexpected exceptions, but it won’t run in this case because the firstexcepthandles the error.
else:
- If there were no exceptions, the
elseblock would print the result.
finally:
- This block runs at the end of the
try/exceptstructure, regardless of whether an exception occurred or not. It’s useful for cleanup actions.
In this case I might not use the else or finally
Benefits of Using try and except:
- Prevents Crashes: By handling exceptions, you can prevent your program from crashing due to unforeseen errors.
- Cleaner Code: It allows for clearer separation of normal code and error handling.
- More Robust Programs: By anticipating and handling potential errors, your programs can handle unexpected situations better.
9.3 for Loops in Python
for loops iterate over a sequence (list, tuple, string, dictionary, set, or range) and perform processes. The syntax of a for loop is simple but must be carefully followed, especially with respect to the colon (:) and indentation.
Syntax
- The
forkeyword is followed by a variable name (e.g.,item) that will take on the value of each element in the sequence.
- The sequence can be a list, tuple, string, or any iterable object.
- The colon (
:) indicates the start of the loop block.
- The indented lines that follow the colon are the code that will be executed.
for item in sequence:
print(x) # Code block to execute
Example:
animals = ["dog", "cat", "rabbit", "elephant", "tiger"]
for animal in animals:
print(f'I have a {animal}.')
Output
I have a dog.
I have a cat.
I have a rabbit.
I have an elephant.
I have a tiger.
9.4 Using len() and range() in for loops
In Python, len() and range() are often used with for loops to control iterations and access elements by their index.
Using len()
The len() function returns the number of items in an iterable (like a list, tuple, or string). This is useful when you need to loop through each element of a sequence without manually specifying the length.
Using range
The range() function generates a sequence of numbers, which can be useful for iterating over a sequence with a specified start and end. The syntax is range(start, stop[, step])
# Loop through the first five integers
for num in range(5):
print(num)
Examples:
animals = ["dog", "cat", "rabbit", "elephant"]
for i in range(len(animals)): # only 1 value - stop
print(f"Animal at index {i}: {animals[i]}")
for i in range(0,len(animals),2): #start, stop, step
print(f"Animal at index {i}: {animals[i]}")
9.5 Using enumerate() in for Loops
The enumerate() function in Python adds a counter to an iterable and returns it as an enumerate object. This is particularly useful when you want to loop through a sequence and keep track of the index of each item without using range().
Syntax
The syntax of enumerate() is as follows:
enumerate(iterable, start=0)- iterable: The sequence (like a list, tuple, or string) you want to iterate over.
- start: The starting index (default is 0).
Example of enumerate() Here’s a simple example demonstrating how to use enumerate() with a list of animals:
animals = ["dog", "cat", "rabbit", "elephant"]
for index, animal in enumerate(animals):
print(f"Animal {index}: {animal}")
output:
Animal 0: dog
Animal 1: cat
Animal 2: rabbit
Animal 3: elephant
Benefits of Using enumerate()
- Clarity: It makes the code cleaner and more readable by eliminating the need to manually manage the index.
- Convenience: Automatically handles the index tracking for you, reducing the risk of errors.
9.6 match Statements
9.6.1 A newer way of working with conditionals!
match statements (Python 3.10 onwards) allow for structural pattern matching, which is a more powerful and flexible version of if-elif chains. With match, you can compare variables to patterns and handle complex matching scenarios in a clear, concise way, and also directly deconstruct variables!
| Feature | if Statements | match Statements |
|---|---|---|
| Simplicity for Basic Cases | Easy for simple comparisons | Similar simplicity for simple matches |
| Handling Complex Structures | Requires manual decomposition | Can match directly on structures |
| Deconstruction | Requires explicit unpacking | Automatically deconstructs data structures |
| Type Matching | Needs isinstance() checks |
Can match types directly |
| Readability | Becomes verbose with complex logic | More concise for complex scenarios |
| Flexibility | Can use if-elif-else chains for conditions |
Can handle advanced pattern matching with custom conditions |
Example:
filtered_sequences = []
dna_sequences = [
"ATCGTAGCTAGCTAGCTAGCTA",
"ATCG",
"ATGCGTAGCTAGCTAGCTAGCTAGCTAG",
12345,
"ATCGTAGCTAGCTAGCTAGCTAGC"
]
for sequence in dna_sequences:
match sequence:
case str():
print(f' reported DNA is {sequence}')
filtered_sequences.append(sequence)
case int():
print(f'{sequence} is not DNA')
case _:
print(f'{sequence} is not DNA')
print(filtered_sequences)
Output:
reported DNA is ATCGTAGCTAGCTAGCTAGCTA
reported DNA is ATCG
reported DNA is ATGCGTAGCTAGCTAGCTAGCTAGCTAG
12345 is not DNA
reported DNA is ATCGTAGCTAGCTAGCTAGCTAGC
['ATCGTAGCTAGCTAGCTAGCTA', 'ATCG', 'ATGCGTAGCTAGCTAGCTAGCTAGCTAG', 'ATCGTAGCTAGCTAGCTAGCTAGC']
Automatic Unpacking with match statements:
dna_data = {
"sequence": "AGCTAGCCTAAGT",
"length": 12,
"type": "coding"
}
# match statement to unpack DNA information
match dna_data:
case {"sequence": sequence, "length": length, "type": type}:
print(f"The DNA sequence is {sequence}, it has a length of {length} bases, and it is of type '{type}'.")
case {"sequence": sequence, "length": length}:
print(f"The DNA sequence is {sequence} and has a length of {length} bases, but type information is missing.")
case {"sequence": sequence}:
print(f"The DNA sequence is {sequence}, but length and type information are missing.")
case _:
print("Unknown DNA data.")
Output:
The DNA sequence is AGCTAGCCTAAGT, it has a length of 12 bases, and it is of type 'coding'.
This can be incredibly useful when writing functions which we will get on to shortly
9.7 List Comprehensions
List comprehensions in python enable you to write shorter and sometimes faster code than standard loops. The syntax is:
[expression for item in iterable if condition]
Similar tools occur for dictionaries (Dictionary comprehension)
9.8 while Loops in Python
A while loop in Python is a control flow statement that allows code to be executed repeatedly based on a boolean condition. The loop continues to execute as long as the condition remains True. Here’s a breakdown of how while loops work:
Key Components
Condition: The loop starts with a condition that is evaluated before each iteration. If the condition is
True, the code block within the loop is executed.Code Block: The statements inside the loop are indented, and these will run repeatedly as long as the condition remains
True.Increment/Decrement: It’s crucial to modify the variable used in the condition within the loop; otherwise, you may create an infinite loop.
Exit: Once the condition evaluates to
False, the loop stops, and the program continues with the next line of code following the loop.
Syntax
while condition:
# Code block to execute
# Update condition variable
Example
Here’s a simple example to illustrate how a while loop works:
count = 0
while count < 5:
print("Count is:", count)
count += 1 # Increment count
Explanation of the Example
Initialization: The variable
countis initialized to0.Condition: The
whileloop checks ifcountis less than5.Code Execution: If the condition is
True, it prints the current value ofcount.Increment: The line
count += 1increments the value ofcountby1after each iteration.Termination: Once
countreaches5, the condition becomesFalse, and the loop exits.
This can be incredibly useful in simulations. Or when interacting in the environment. Here the number of iterations is not known beforehand and depend on a certain condition being met. They provide a way to repeat actions and process data dynamically within a program.
However
Infinite Loops: Ensure the condition will eventually evaluate to
Falseto avoid infinite loops.Break Statement: You can use the
breakstatement to exit a loop prematurely if needed.Continue Statement: The
continuestatement can skip the current iteration and proceed to the next one based on a condition.
An example is:
import random
population = 1000
infected = 1
days = 0
infection_rate = 1.5
max_days = 30
while infected < population:
days += 1
if random.random() > 0.9:
print(f"Day {days}: Lockdown in effect, no new infections today.")
continue
new_infections = int(infected * infection_rate)
if new_infections + infected > population:
new_infections = population - infected
infected += new_infections
print(f"Day {days}: {infected} infected.")
if infected >= population:
print(f"Day {days}: The entire population is infected.")
break
if random.random() > 0.8:
print(f"Day {days}: Health measures implemented, slowing infection.")
infection_rate -= 0.3
if infection_rate <= 0.1:
print(f"Day {days}: The infection has nearly stopped spreading.")
break
if days >= max_days:
print("The simulation has reached its time limit.")
break
9.9 Summary
Python has many ways to work with conditions and loops. It is key for these statements to be written concisely, while catching edge cases and dealing with errors.
By this point you should be comfortable with:
if,elif,elsestatementsmatch,casestatementsforloops withrange(),len(), andenumerate()- Working with different composite data types
tryandexceptfor error handlingwhileloops